addgene plasmid (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+puro+plasmid/pX330-Puro-ccdB+(Plasmid+%2382580)/pm41875887-830-60-60
Average 92 stars, based on 9 article reviews
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+puro+plasmid/pX330-Puro-ccdB+(Plasmid+%2382580)/pm41875887-830-60-60
Average 92 stars, based on 9 article reviews
addgene plasmid - by Bioz Stars,
2026-09
92/100 stars
Images
Related Articles
Clone Assay:Article Title: Functional genomic screens with death rate analyses reveal mechanisms of drug action. Article Snippet: A common approach for understanding how drugs induce their therapeutic effects is to identify the genetic determinants of drug sensitivity.. Because ‘chemo-genetic profiles’ are performed in a pooled format, inference of gene function is subject to several confounding influences related to variation in growth rates between clones.. In this study, we developed Method for Evaluating Death Using a Simulation-assisted Approach (MEDUSA), which uses time-resolved measurements, along with model-driven constraints, to reveal the combination of growth and death rates that generated the observed drug response. Article Title: Pol II degradation activates cell death independently from the loss of transcription Article Snippet: .. For each gene, the highest-scoring sgRNA was selected from the TKOv3 library (PTBP1: 5’ – CGAGGTGTAGTAGTTCACCA – 3’; BCL2L12: 5’ – AGAAGGAAGCCATACTGCGG – 3’) and cloned into the Article Title: Genome-wide profiling identifies the genetic dependencies of cell death following EGFR inhibition. Article Snippet: .. 565 J urn al Pr e-p roo f 24 566 Screen validation 567 Selected guides were cloned into the Article Title: The impact of VPS35 D620N mutation on alternative autophagy and its reversal by estrogen in Parkinson's disease. Article Snippet: .. The sgRNA sequence was cloned into the Article Title: RNA Pol II inhibition activates cell death independently from the loss of transcription. Article Snippet: For each gene, the highest-scoring sgRNA (see Table S1) was selected from the TKOv3 library and cloned into the pX330-puro plasmid using the single-step digestion-ligation protocol from the Zhang laboratory (available on the Zhang laboratory Addgene page). .. For each gene, the highest-scoring sgRNA (see Table S1) was selected from the TKOv3 library and cloned into the Article Title: RNA Pol II inhibition activates cell death independently from the loss of transcription Article Snippet: .. For each gene, the highest-scoring sgRNA (see ) was selected from the TKOv3 library and cloned into the Plasmid Preparation:Article Title: Functional genomic screens with death rate analyses reveal mechanisms of drug action. Article Snippet: A common approach for understanding how drugs induce their therapeutic effects is to identify the genetic determinants of drug sensitivity.. Because ‘chemo-genetic profiles’ are performed in a pooled format, inference of gene function is subject to several confounding influences related to variation in growth rates between clones.. In this study, we developed Method for Evaluating Death Using a Simulation-assisted Approach (MEDUSA), which uses time-resolved measurements, along with model-driven constraints, to reveal the combination of growth and death rates that generated the observed drug response. Article Title: Pol II degradation activates cell death independently from the loss of transcription Article Snippet: .. For each gene, the highest-scoring sgRNA was selected from the TKOv3 library (PTBP1: 5’ – CGAGGTGTAGTAGTTCACCA – 3’; BCL2L12: 5’ – AGAAGGAAGCCATACTGCGG – 3’) and cloned into the Article Title: Genome-wide profiling identifies the genetic dependencies of cell death following EGFR inhibition. Article Snippet: .. 565 J urn al Pr e-p roo f 24 566 Screen validation 567 Selected guides were cloned into the Article Title: The impact of VPS35 D620N mutation on alternative autophagy and its reversal by estrogen in Parkinson's disease. Article Snippet: .. The sgRNA sequence was cloned into the Article Title: Pluripotency factor Tex10 finetunes Wnt signaling for spermatogenesis and primordial germ cell development Article Snippet: The loxP-dsRed-loxP fragment and the above modified pJet1.2 plasmid were digested with restriction enzymes AgeI (NEB, R0552S) and PacI (NEB, R0547S) and then ligated using T4 DNA ligase (NEB, M0202S) to get pAW63-Tex10 plasmid. .. The Tex10 guide RNA sequence was inserted into the Article Title: RNA Pol II inhibition activates cell death independently from the loss of transcription. Article Snippet: For each gene, the highest-scoring sgRNA (see Table S1) was selected from the TKOv3 library and cloned into the pX330-puro plasmid using the single-step digestion-ligation protocol from the Zhang laboratory (available on the Zhang laboratory Addgene page). .. For each gene, the highest-scoring sgRNA (see Table S1) was selected from the TKOv3 library and cloned into the Article Title: RNA Pol II inhibition activates cell death independently from the loss of transcription Article Snippet: .. For each gene, the highest-scoring sgRNA (see ) was selected from the TKOv3 library and cloned into the Article Title: Pluripotency factor Tex10 finetunes Wnt signaling for spermatogenesis and primordial germ cell development. Article Snippet: The loxP-dsRed-loxP fragment and the above modified pJet1.2 plasmid were digested with restriction enzymes AgeI (NEB, R0552S) and PacI (NEB, R0547S) and then ligated using T4 DNA ligase (NEB, M0202S) to get pAW63-Tex10 plasmid. .. The Tex10 guide RNA sequence was inserted into the Biomarker Discovery:Article Title: Genome-wide profiling identifies the genetic dependencies of cell death following EGFR inhibition. Article Snippet: .. 565 J urn al Pr e-p roo f 24 566 Screen validation 567 Selected guides were cloned into the Sequencing:Article Title: The impact of VPS35 D620N mutation on alternative autophagy and its reversal by estrogen in Parkinson's disease. Article Snippet: .. The sgRNA sequence was cloned into the Article Title: Pluripotency factor Tex10 finetunes Wnt signaling for spermatogenesis and primordial germ cell development Article Snippet: The loxP-dsRed-loxP fragment and the above modified pJet1.2 plasmid were digested with restriction enzymes AgeI (NEB, R0552S) and PacI (NEB, R0547S) and then ligated using T4 DNA ligase (NEB, M0202S) to get pAW63-Tex10 plasmid. .. The Tex10 guide RNA sequence was inserted into the Article Title: Pluripotency factor Tex10 finetunes Wnt signaling for spermatogenesis and primordial germ cell development. Article Snippet: The loxP-dsRed-loxP fragment and the above modified pJet1.2 plasmid were digested with restriction enzymes AgeI (NEB, R0552S) and PacI (NEB, R0547S) and then ligated using T4 DNA ligase (NEB, M0202S) to get pAW63-Tex10 plasmid. .. The Tex10 guide RNA sequence was inserted into the |